 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circRNA_001569 | |||
| Gene | n/a | Organism | Human |
| Genome Locus | n/a | Build | hg19 |
| Disease | Gastric Cancer | ICD-10 | Stomach, Malignant neoplasm of unspecified (C16.9) |
| DBLink | Link to database | PMID | 30304349 |
| Experimental Method | |||
| Sample Type | Tissues and Cell lines | Comparison | tumor tissues were obtained from the 30 patients, The normal tissues were the adjacent cancer tissues that collected from more than 5 cm away from the tumors tissues and Human gastric cancer cell lines SGC-7901 and MGC-803, human normal gastric mucosal cell line GES-1 |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward CACCGCATTAACCATCGGGA ReverseGACTTGCGACTTACGACTCTA | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
| Citation | |||
| Shen, F, Liu, P, Xu, Z, Li, N, Yi, Z, Tie, X, Zhang, Y, Gao, L (2019). CircRNA_001569 promotes cell proliferation through absorbing miR-145 in gastric cancer. J. Biochem., 165, 1:27-36. | |||